View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9893_low_62 (Length: 236)

Name: NF9893_low_62
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9893_low_62
NF9893_low_62
[»] chr5 (1 HSPs)
chr5 (88-204)||(18095950-18096066)


Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 88 - 204
Target Start/End: Complemental strand, 18096066 - 18095950
Alignment:
88 gaaacatataacacctcaaaatcacttctgaaatcaattaccgatttaatctcagatcttactaaattcatggtttaattttttcacaaattcagcatta 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
18096066 gaaacatataacacctcaaaatcacttctgaaatcaattaccgatttaatctcagatcttactaaattcatggtttaattttttcaaaaattcagcatta 18095967  T
188 aatctactaaaataact 204  Q
    |||||||||||||||||    
18095966 aatctactaaaataact 18095950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University