View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9893_low_71 (Length: 217)

Name: NF9893_low_71
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9893_low_71
NF9893_low_71
[»] chr6 (1 HSPs)
chr6 (1-201)||(32384389-32384589)


Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 32384389 - 32384589
Alignment:
1 aaccaaaaatgaaagaacttcagaatgttaacagatgaaataagacctggaataatctctcacgtgaaaatataggaagatgaaagtatatattgaatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32384389 aaccaaaaatgaaagaacttcagaatgttaacagatgaaataagacctggaataatctctcacgtgaaaatataggaagatgaaagtatatattgaatca 32384488  T
101 taactaacagaaaacttacagaattagctcctctagcttttgcttcttcagatgtctccaattgctccactcgcccaaccttatatcttcacaatggaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32384489 taactaacagaaaacttacagaattagctcctctagcttttgcttcttcagatgtctccaattgctccactcgcccaaccttatatcttcacaatggaaa 32384588  T
201 a 201  Q
    |    
32384589 a 32384589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University