View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_low_72 (Length: 216)
Name: NF9893_low_72
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_low_72 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 200
Target Start/End: Original strand, 50336867 - 50337054
Alignment:
| Q |
13 |
tttggtgttattactttataaatagatatattctagatgcataaaatgacatgaaattagtgtttttgaacctaaactcaaataccattttcgaaattag |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50336867 |
tttgatgttattactttataaatagatatattctagatgcataaaatgacatgaaattagtgtttttgaacctaaactcaaataccattttcgaaattag |
50336966 |
T |
|
| Q |
113 |
agatctttattctctagagcaagagtaagtggaggaactctgtaatgtgtaaaatactattgagagacaacttcagcgtgcaatttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50336967 |
agatctttattctctagagcaagagtaagtggaggaactctgtaatgtgtaaaatactattgagagacaacttcagtgtgcaatttgt |
50337054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University