View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9893_low_73 (Length: 213)

Name: NF9893_low_73
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9893_low_73
NF9893_low_73
[»] chr7 (1 HSPs)
chr7 (13-193)||(36586220-36586406)


Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 36586220 - 36586406
Alignment:
13 caaaggtacaaaatttgctttcaatttcctttcttagccactctgtccaatccaatgttctgggttcatgagtggatgtacccctttttaccctcttttt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36586220 caaaggtacaaaatttgctttcaatttcctttcttagccactctgtccaatccaatgttctgggttcatgagtggatgtacccctttttaccctcttttt 36586319  T
113 tgctttcacttgctccgtaaatgaaggtgtctttatctcctctatctctttct------ctttcccataccctatcaataaatcttt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||    
36586320 tgctttcacttgctccgtaaatgaaggtgtctttatctcctctatctctttctctttccctttcccataccctatcaataaatcttt 36586406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University