View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9893_low_73 (Length: 213)
Name: NF9893_low_73
Description: NF9893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9893_low_73 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 36586220 - 36586406
Alignment:
| Q |
13 |
caaaggtacaaaatttgctttcaatttcctttcttagccactctgtccaatccaatgttctgggttcatgagtggatgtacccctttttaccctcttttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36586220 |
caaaggtacaaaatttgctttcaatttcctttcttagccactctgtccaatccaatgttctgggttcatgagtggatgtacccctttttaccctcttttt |
36586319 |
T |
 |
| Q |
113 |
tgctttcacttgctccgtaaatgaaggtgtctttatctcctctatctctttct------ctttcccataccctatcaataaatcttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36586320 |
tgctttcacttgctccgtaaatgaaggtgtctttatctcctctatctctttctctttccctttcccataccctatcaataaatcttt |
36586406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University