View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9894_high_21 (Length: 214)
Name: NF9894_high_21
Description: NF9894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9894_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 47184013 - 47183835
Alignment:
| Q |
17 |
aaggtaaatggttttaggtattatggagttttggtcataagataaataaaatttgaacatagattgatctagttagaatttgatctcaagttaccaatat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47184013 |
aaggtaaatggttttaggtattatggagttttggtcataagataaataaaatttgaacatagattgatctagttagaatttgatctcaagttaccaatat |
47183914 |
T |
 |
| Q |
117 |
cataagaacgtataaatacaaaatcagaacaaaaacctttagaataaggcaatataaatgtacctgaaataccaatatc |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47183913 |
cataagaacgtataagtacaaaatcagaacaaaaacctttagaataaggctatataaatgtacctgaaataccaatatc |
47183835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University