View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9894_low_19 (Length: 244)
Name: NF9894_low_19
Description: NF9894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9894_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 240
Target Start/End: Complemental strand, 12737179 - 12736947
Alignment:
| Q |
8 |
accaccaacaccaagccttacccactcttaagataatgcccccactgaagggagtttgtacaggaaaagggcttgtcgggcaaagtggaactatttttca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12737179 |
accaccaacaccaagccttacccactcttaagataatgcccccactgaagggagtttgtacaggaaaagggcttgtcgggcaaagtggaactatttttca |
12737080 |
T |
 |
| Q |
108 |
tgtgctcaaattatgataagttatggtcttggctattaagtttccataaacatacacatcaatttcccttatatgcattgccaaacctcagttataggaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||| || |||| |||||| |
|
|
| T |
12737079 |
tgtgctcaaattatgataagttatggtcttggctattaagtttccataaacagacacatcaattttccttatatccattgccaaatctaagttttaggaa |
12736980 |
T |
 |
| Q |
208 |
aaagaccatcccacaagttgttgccatctgtgc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12736979 |
aaagaccatcccacaagttgttgccatctgtgc |
12736947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University