View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9894_low_25 (Length: 220)
Name: NF9894_low_25
Description: NF9894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9894_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 31224874 - 31224687
Alignment:
| Q |
17 |
aggcacaatgaatcagttgagaaacaaggtggtccatgtaaccgtgatgaccttttgactcaccgttatgttcaacgacaagagagggaaatccgtcgtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31224874 |
aggcacaatgaatcagttgagaaacaagggggtccatgtaaccgcgacgaccttttgactcaccgttatgttcgacgacaagagagggaaatccgtcgtt |
31224775 |
T |
 |
| Q |
117 |
ctacatatgagcgagatgctgatgactctgttagcatcagcatgtgggttaaaagccaccagagtgatgttttcttctacgaagattt |
204 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||||||||||||||| |||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
31224774 |
ctacatatgagctagatgctgatgattctgttagtatcagcatgtgggttgaaagccgccagagtaatgttttcttctaccaagattt |
31224687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University