View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9895_high_12 (Length: 241)
Name: NF9895_high_12
Description: NF9895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9895_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 9 - 219
Target Start/End: Complemental strand, 23937551 - 23937341
Alignment:
| Q |
9 |
ccatgtctaattctctcataattgttaaaaatgatgtaactttgtaaggttggcttttaatattgtccaannnnnnngtgtgatactttgtcctttcaac |
108 |
Q |
| |
|
|||||| ||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23937551 |
ccatgtttaattctctcatagttattacaaatgatgtaactttgtaaggttggcttttaatattgtccaattttcttgtgtgatactttgtcctttcaac |
23937452 |
T |
 |
| Q |
109 |
agctttttatccatcaacacctgaagttggggattctttgaagaaagcccagcaagaaaaatctgcagctattgcctcacgggctttgcaaatgtgcaag |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23937451 |
agctttttatccatcaatacctgaagttggggattctttgaagaaagcccagcaagaaaaatctgcagctattgcctcacaggctttgcaaatgtgcaag |
23937352 |
T |
 |
| Q |
209 |
gataagcaggt |
219 |
Q |
| |
|
||||||||||| |
|
|
| T |
23937351 |
gataagcaggt |
23937341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 23931648 - 23931535
Alignment:
| Q |
103 |
ttcaacagctttttatccatcaacacctgaagttggggattctttgaagaaagcccagcaagaaaaatctgcagctattgcctcacgggctttgcaaatg |
202 |
Q |
| |
|
||||||||||||||||||| || | || |||| |||||| ||||||||| ||||||||||| ||| |||| |||| || ||||||||||||||| |
|
|
| T |
23931648 |
ttcaacagctttttatccagcatc---tgtggttgtggattcagtgaagaaaggccagcaagaaagatcagcagttattctttcccgggctttgcaaatg |
23931552 |
T |
 |
| Q |
203 |
tgcaaggataagcaggt |
219 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
23931551 |
tgcaaggataagcaggt |
23931535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University