View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9895_high_13 (Length: 241)
Name: NF9895_high_13
Description: NF9895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9895_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 51220877 - 51220725
Alignment:
| Q |
1 |
ctcgttattgttaacttcatgagttatttttaatttatggtctattgagtatgttgcttttgaaatttctgtgttaatttatttgtttgttagagttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51220877 |
ctcgttattgttaacttcatgagttatttttaatttatggtctattgagtctgttgcttttgaaatttctgtgttaatttatttgtttgttagagttatt |
51220778 |
T |
 |
| Q |
101 |
ggttttgtcatcaagcattacattttatgtagttaacaattactgaatctagt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51220777 |
ggttttgtcatcaagcattacattttatgtagttaacaattactgaatctagt |
51220725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 77 - 126
Target Start/End: Complemental strand, 51756370 - 51756321
Alignment:
| Q |
77 |
atttatttgtttgttagagttattggttttgtcatcaagcattacatttt |
126 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
51756370 |
atttatttgttagttagagttgttgattttgtcatcatgcattacatttt |
51756321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University