View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9895_high_7 (Length: 276)
Name: NF9895_high_7
Description: NF9895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9895_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 266
Target Start/End: Complemental strand, 41622815 - 41622566
Alignment:
| Q |
17 |
aactttaagcctattgatgagtttatccattgctttgtctctaacacttttaaactccttgagtctagttgaactcagcatgttctgaaccatgtttctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41622815 |
aactttaagcctattgatgagtttatccattgctttgtctctaacacttttaaactccttgagtctagttgaactcagcatgttctgaaccatgtttctt |
41622716 |
T |
 |
| Q |
117 |
ctcagtgatttccaaactggaccataaactgcagcattcacagtgaacttgttggcactgaatatgttccttgttggattctcaggtggtctagatgcat |
216 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41622715 |
cttagtgatttccaaacaggaccataaactgcagcattcacagtgaacttgtttgcactgaatatgttccttgttggattctcaggtggtctagatgcat |
41622616 |
T |
 |
| Q |
217 |
agagagcacctttttgaatgaaagcttcatgcacaagttttgcatctgtg |
266 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41622615 |
agagagcacccttttgaatgaaagcttcatgcacaagttttgcatctgtg |
41622566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University