View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9895_low_14 (Length: 226)
Name: NF9895_low_14
Description: NF9895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9895_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 211
Target Start/End: Complemental strand, 37272979 - 37272780
Alignment:
| Q |
12 |
aacctgtgatgcagcttttgcagcacaacaaatagctgaaatagcagaaggatcatcagacaaccgtggtttagcacttttgttaccattaattccagcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37272979 |
aacctgtgatgcagcttttgcagcacaacaaatagctgaaatagcagaaggatcatcagacaaccgtggtttagcacttttgttaccattaattccagcc |
37272880 |
T |
|
| Q |
112 |
attgcttgggttctgtacaacattcttcaaccagcacttaaccaaatcaaccgtatgcgtaacgataaaggagttataattggtttaggtcttgggggtg |
211 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37272879 |
atagcttgggttctgtacaacattcttcaaccagcacttaaccaaatcaaccgtatgcgtaacgataaaggagttataattggtttaggtcttgggggtg |
37272780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 32 - 211
Target Start/End: Complemental strand, 20581012 - 20580833
Alignment:
| Q |
32 |
cagcacaacaaatagctgaaatagcagaaggatcatcagacaaccgtggtttagcacttttgttaccattaattccagccattgcttgggttctgtacaa |
131 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||| |||| |||||||| ||| |
|
|
| T |
20581012 |
cagcacaacagatagctgaaatagcagaaggatcatcagacaaccgcggttaagcacttctgttaccattaattccagccatagcttcggttctgttcaa |
20580913 |
T |
|
| Q |
132 |
cattcttcaaccagcacttaaccaaatcaaccgtatgcgtaacgataaaggagttataattggtttaggtcttgggggtg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
20580912 |
cattcttcaaccagcacttaaccaaatcaaccgtatgcgtaacgataaaggagttatcattggtttgggtcttggtggtg |
20580833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University