View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9896_low_23 (Length: 208)
Name: NF9896_low_23
Description: NF9896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9896_low_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 46438127 - 46438338
Alignment:
| Q |
1 |
cctattactgctttggaaatggagtattccttatggtcccgtgacattgaagaagaaataaatccactctgcaggtatataagttgaaatgttttctgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46438127 |
cctattactgctttggaaatggagtattccttatggtcccgtgacattgaagaagaaataattccactctgcaggtatattagttgaaatgttttctgct |
46438226 |
T |
 |
| Q |
101 |
catatagcactagttacaatgatactcaa----gtatatcataaattgtttttattgttactaagaagctttgtgtactttcagagatcttggcattgga |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
46438227 |
catatagcactagttacaatgatactcaagtacgtatatcataaattgtttttatcgttactaagaagctttgtgtacttgcagagagcttggcattgga |
46438326 |
T |
 |
| Q |
197 |
attgtagcatac |
208 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46438327 |
attgtagcatac |
46438338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University