View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9896_low_24 (Length: 207)
Name: NF9896_low_24
Description: NF9896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9896_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 176
Target Start/End: Original strand, 51489401 - 51489559
Alignment:
| Q |
18 |
ccaatgaattccaacatatgaggtgttaaacattttttggtttggttgtaaaattatgtttcatcttctccttatgttttaaaatgctatcttaatgtgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51489401 |
ccaatgaattccaacatatgaggtgttaaacattttttggtttggttgtaaaattatgtttcatcttcgccttatgttttaaaatgctatcttaatgtgc |
51489500 |
T |
|
| Q |
118 |
tgctacccaatatagcattttttggtttagtaacctcttctcatgaaattgaatcaacc |
176 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51489501 |
tgctaccctatatagcactttttggtttagtaacctcttctcatgaaattgaatcaacc |
51489559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University