View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9897_low_3 (Length: 308)
Name: NF9897_low_3
Description: NF9897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9897_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 169 - 292
Target Start/End: Original strand, 15790239 - 15790362
Alignment:
| Q |
169 |
agtggaagaaaccgtccaactgaactcttaaatgtccacgagcttacacgtcgaattgaaaaagtgttgcgactaccagcacaataacggtcaccctaga |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15790239 |
agtggaagaaaccgtccaactgaactcttaaatgtccacgagcttacacgtcgaatttaaaaagtgttgcgacttccagcacaataacggtcaccctaga |
15790338 |
T |
|
| Q |
269 |
gttacagttatccccagtccacat |
292 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
15790339 |
gttacagttatcaccagtccacat |
15790362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 15789674 - 15789738
Alignment:
| Q |
1 |
ttgagaaaacaaaaacttgtgctacaagaattccatggttgttttctcaaatttcaatgcaatag |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15789674 |
ttgagaaaacaaaaacttgtgctacaagaattccatggttgttttctcaaatttcaatgcaatag |
15789738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 15789789 - 15789892
Alignment:
| Q |
81 |
atttggattcctgtcatttaattccaaaacaaattaaccttaac--------------caactggttggttaatgcgatccaccaaaggacgaatcattc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15789789 |
atttggattcctgtcatttaattccaaaacaaattaaccttaaccaagtggttgggctcaactggttggttaatgcgatccaccaaaggacgaatcattc |
15789888 |
T |
|
| Q |
167 |
gcag |
170 |
Q |
| |
|
|||| |
|
|
| T |
15789889 |
gcag |
15789892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University