View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9897_low_9 (Length: 234)
Name: NF9897_low_9
Description: NF9897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9897_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 72 - 224
Target Start/End: Original strand, 39799091 - 39799239
Alignment:
| Q |
72 |
tctcatttctatccatttttcactcatttactctctgatctctttctccccccagcctcccctaatcaccacatcattttcattcacatttatattgttt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39799091 |
tctcatttctatccatttttcactcatttactctct-----ctttctccccccagcctcccctaatcaccacatcattttcattcacatttatattgttt |
39799185 |
T |
|
| Q |
172 |
gagagggatgcatgtt-gggggatctaaattcgttttctatagtgtcacctatg |
224 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39799186 |
gagagggatgcatgttggggggatctaaattcgttttctatagtgtcacctatg |
39799239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 39799056 - 39799089
Alignment:
| Q |
23 |
acggacttagattctctcccacaaaatttatcta |
56 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
39799056 |
acggacttatattctctcccacaaaatttatcta |
39799089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University