View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9898_high_6 (Length: 270)

Name: NF9898_high_6
Description: NF9898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9898_high_6
NF9898_high_6
[»] chr7 (5 HSPs)
chr7 (20-242)||(28288576-28288798)
chr7 (125-160)||(28320553-28320588)
chr7 (121-157)||(28304384-28304420)
chr7 (132-163)||(28331029-28331060)
chr7 (127-160)||(28309979-28310012)


Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 242
Target Start/End: Original strand, 28288576 - 28288798
Alignment:
20 agacccacaacgattgtatgcaaagatggccattcatctggggagtttgtgcgagattattggaggaatcattgaagaaagaagagcttccaagattgat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
28288576 agacccacaacgattgtatgcaaagatggccattcatctggggagtttgtgtgagattattggaggaatcattgaagaaagaagagcttccaagattgat 28288675  T
120 tctgatgaggtttgcaatgatgtgttagattcacttcttaacaataatggagaaactattttcgatcagttgagtccgaaggagttgtttcatctgcttc 219  Q
    |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||    
28288676 tctgatcaggtttgcaatgatgtgttagattcacttcttaacaatgatggagaaactattttcgatcagttgagtccgaaggagatgtttcatctgcttc 28288775  T
220 cggttagtgttattttctcatga 242  Q
    |||||||||||||||||||||||    
28288776 cggttagtgttattttctcatga 28288798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 160
Target Start/End: Complemental strand, 28320588 - 28320553
Alignment:
125 tgaggtttgcaatgatgtgttagattcacttcttaa 160  Q
    ||||||||||||||||||||||||||||||||||||    
28320588 tgaggtttgcaatgatgtgttagattcacttcttaa 28320553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 157
Target Start/End: Complemental strand, 28304420 - 28304384
Alignment:
121 ctgatgaggtttgcaatgatgtgttagattcacttct 157  Q
    ||||||||||||||||||||| |||||||||||||||    
28304420 ctgatgaggtttgcaatgatgggttagattcacttct 28304384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 132 - 163
Target Start/End: Complemental strand, 28331060 - 28331029
Alignment:
132 tgcaatgatgtgttagattcacttcttaacaa 163  Q
    ||||||||||||||||||||||||||||||||    
28331060 tgcaatgatgtgttagattcacttcttaacaa 28331029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 160
Target Start/End: Complemental strand, 28310012 - 28309979
Alignment:
127 aggtttgcaatgatgtgttagattcacttcttaa 160  Q
    |||| |||||||||||||||||||||||||||||    
28310012 aggtgtgcaatgatgtgttagattcacttcttaa 28309979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University