View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9898_high_6 (Length: 270)
Name: NF9898_high_6
Description: NF9898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9898_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 242
Target Start/End: Original strand, 28288576 - 28288798
Alignment:
| Q |
20 |
agacccacaacgattgtatgcaaagatggccattcatctggggagtttgtgcgagattattggaggaatcattgaagaaagaagagcttccaagattgat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28288576 |
agacccacaacgattgtatgcaaagatggccattcatctggggagtttgtgtgagattattggaggaatcattgaagaaagaagagcttccaagattgat |
28288675 |
T |
|
| Q |
120 |
tctgatgaggtttgcaatgatgtgttagattcacttcttaacaataatggagaaactattttcgatcagttgagtccgaaggagttgtttcatctgcttc |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28288676 |
tctgatcaggtttgcaatgatgtgttagattcacttcttaacaatgatggagaaactattttcgatcagttgagtccgaaggagatgtttcatctgcttc |
28288775 |
T |
|
| Q |
220 |
cggttagtgttattttctcatga |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28288776 |
cggttagtgttattttctcatga |
28288798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 160
Target Start/End: Complemental strand, 28320588 - 28320553
Alignment:
| Q |
125 |
tgaggtttgcaatgatgtgttagattcacttcttaa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28320588 |
tgaggtttgcaatgatgtgttagattcacttcttaa |
28320553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 157
Target Start/End: Complemental strand, 28304420 - 28304384
Alignment:
| Q |
121 |
ctgatgaggtttgcaatgatgtgttagattcacttct |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28304420 |
ctgatgaggtttgcaatgatgggttagattcacttct |
28304384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 132 - 163
Target Start/End: Complemental strand, 28331060 - 28331029
Alignment:
| Q |
132 |
tgcaatgatgtgttagattcacttcttaacaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28331060 |
tgcaatgatgtgttagattcacttcttaacaa |
28331029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 160
Target Start/End: Complemental strand, 28310012 - 28309979
Alignment:
| Q |
127 |
aggtttgcaatgatgtgttagattcacttcttaa |
160 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
28310012 |
aggtgtgcaatgatgtgttagattcacttcttaa |
28309979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University