View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9898_low_3 (Length: 345)
Name: NF9898_low_3
Description: NF9898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9898_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 329
Target Start/End: Complemental strand, 44244365 - 44244037
Alignment:
| Q |
1 |
gaaacaccaacaaaagtaaaacacacataacctcattcatcatcataactagaggaatatatggtagaagaaaagttgaacatcttctaagagttacggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44244365 |
gaaacaccaacaaaagtaaaacacacataacctcattcatcatcataactagaggaatatatggtagaagaaaagttgaacatcttctaagagttacggc |
44244266 |
T |
|
| Q |
101 |
aacgggtgatggtggcacaaccacgggagtaaggattagcttctgcacctgtctgacaattgtaataggatgcacccttgtgtgagcatggcacagtgtt |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44244265 |
aacgggtgatggtggcacagccacgggagtaaggattagcttctgcacctgtctgacaattgtaataggatgcacccttatgtgagcatggcacagtgtt |
44244166 |
T |
|
| Q |
201 |
cctctgcagggctctgtagcttatatagtgtgtggttgctaggatacgccggtgagactctgaattcattccaaactcaccttcttctatgcactcttct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44244165 |
cctctgcagggctctgtagcttatatagtgtgtggttgctaggatacgccggtgagactctgaattcattccaaactcaccttcttctatgcactcttct |
44244066 |
T |
|
| Q |
301 |
atagagccttggcaagttggtgttgtcat |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44244065 |
atagagccttggcaagttggtgttgtcat |
44244037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University