View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9898_low_7 (Length: 265)
Name: NF9898_low_7
Description: NF9898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9898_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 9699922 - 9699671
Alignment:
| Q |
1 |
tatggtataaaagtttcattaagttgtttatccaaacatgacttaaatttgttgagtcatcagtcatcctgaaagaaaacaatttactcaaccattacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699922 |
tatggtataaaagtttcattaagttgtttatccaaacatgacttaaatttgttgagtcatcagtcatcctgaaagaaaacaatttactcaaccattacct |
9699823 |
T |
|
| Q |
101 |
gaacttatattgataagaagtacatcagggtgataagtaggcaaagatccaccgatcagatcagctacttctaagatgctccacaaaccaaccttggtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699822 |
gaacttatattgataagaagtacatcagggtgataagtaggcaaagatccaccgatcagatcagctacttctaagatgctccacaaaccaaccttggtaa |
9699723 |
T |
|
| Q |
201 |
ggagttcagattttaattgttccttggcaagaatcacgctgctgcacaggtt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9699722 |
ggagttcagattttaattgttccttggcaagaatcacgctgctgtacaggtt |
9699671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 45201123 - 45201156
Alignment:
| Q |
20 |
taagttgtttatccaaacatgacttaaatttgtt |
53 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
45201123 |
taagttgtttatccaaacatgccttaaatttgtt |
45201156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University