View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9900_high_5 (Length: 293)
Name: NF9900_high_5
Description: NF9900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9900_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 8e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 192 - 275
Target Start/End: Complemental strand, 17258734 - 17258649
Alignment:
| Q |
192 |
tctgctaaaacagaatcataaactcttattta-attcatcaggctcaatcttcacagggacgattttcattggc-ttggtaataga |
275 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17258734 |
tctgctaaaacacaatcataaactcttattttcattcatcaggctcaatcttcacagggacgattttcattggctttggtaataga |
17258649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 106 - 158
Target Start/End: Complemental strand, 17258795 - 17258743
Alignment:
| Q |
106 |
ttcaaataagacaacaacgtttaataaagtacacgattaaagccataatccaa |
158 |
Q |
| |
|
|||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17258795 |
ttcaaatagtacaacaccgtttaatgaagtacacgattaaagccataatccaa |
17258743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University