View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9900_high_5 (Length: 293)

Name: NF9900_high_5
Description: NF9900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9900_high_5
NF9900_high_5
[»] chr7 (2 HSPs)
chr7 (192-275)||(17258649-17258734)
chr7 (106-158)||(17258743-17258795)


Alignment Details
Target: chr7 (Bit Score: 62; Significance: 8e-27; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 192 - 275
Target Start/End: Complemental strand, 17258734 - 17258649
Alignment:
192 tctgctaaaacagaatcataaactcttattta-attcatcaggctcaatcttcacagggacgattttcattggc-ttggtaataga 275  Q
    |||||||||||| ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||||||    
17258734 tctgctaaaacacaatcataaactcttattttcattcatcaggctcaatcttcacagggacgattttcattggctttggtaataga 17258649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 106 - 158
Target Start/End: Complemental strand, 17258795 - 17258743
Alignment:
106 ttcaaataagacaacaacgtttaataaagtacacgattaaagccataatccaa 158  Q
    ||||||||  |||||| |||||||| |||||||||||||||||||||||||||    
17258795 ttcaaatagtacaacaccgtttaatgaagtacacgattaaagccataatccaa 17258743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University