View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9901_high_12 (Length: 290)
Name: NF9901_high_12
Description: NF9901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9901_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 64 - 274
Target Start/End: Original strand, 35254363 - 35254573
Alignment:
| Q |
64 |
tcatcactaacttttctaagcttcaattcaattcacaaaaatgaagatatcgttgcagaattattccaattccaaagcaggaacaataagaggaagaaca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35254363 |
tcatcactaacttttctaagcttcaattcaattcacaaaaatgaagatatcgttgcagaattattccaattccaaagcaggaacaataagaggaagaaca |
35254462 |
T |
 |
| Q |
164 |
gtggtattcacatggttttgtgtgtgtgttttcgtagcttcaattatagtagcaggagcagaagctgcgtggttcaaacctttcaacgtcacctacgatc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35254463 |
gtggtattcacatggttttgtgtgtgtgttttcgtagcttcaattatagtagcaggagcagaagctgcgtggttcaaaccgttcaacgtcacctacgatc |
35254562 |
T |
 |
| Q |
264 |
atcgtgctctc |
274 |
Q |
| |
|
||||||||||| |
|
|
| T |
35254563 |
atcgtgctctc |
35254573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 35254300 - 35254334
Alignment:
| Q |
1 |
gttagttggaaatgtaaattgaagcaattcagtac |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35254300 |
gttagttggaaatgtaaattgaagcaattcagtac |
35254334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University