View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9901_high_13 (Length: 265)
Name: NF9901_high_13
Description: NF9901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9901_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 44 - 250
Target Start/End: Complemental strand, 35096882 - 35096676
Alignment:
| Q |
44 |
ttggtgtatgagttctattatctttacattggtgggtagacatgccttttcaagtttcagtttgatcaaaagatcttaatgtcaattgtcaacattatac |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35096882 |
ttggtgtatgagttctattatctttacattggtgggtagacatgccttttcaagtttcagtttgatcaaaatatcttaatgtcaattgtcaacattatac |
35096783 |
T |
 |
| Q |
144 |
tgaattggctcatttcatgctgctggatttccccactcctgctaatgaacagaacattttagtgattgatcattgatgagtagggctgaaaatgatggaa |
243 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
35096782 |
tgaattggctcatttaatgctgctggatttccccactcctgccaatgaacagaacattttagtgattgatcattgatgagtaagactgaaaatgatggaa |
35096683 |
T |
 |
| Q |
244 |
ttactat |
250 |
Q |
| |
|
||||||| |
|
|
| T |
35096682 |
ttactat |
35096676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University