View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9901_high_22 (Length: 240)
Name: NF9901_high_22
Description: NF9901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9901_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 82 - 224
Target Start/End: Complemental strand, 32982240 - 32982098
Alignment:
| Q |
82 |
ttgttggatatgctttttcttgtctttgtttgtttggagatagagagccaattgaattatcttgagaaattacgtggcagaagaaaatttaacactaaaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32982240 |
ttgttggatatgctttttcttgtctttgtttgtttggagatagagagccaattgaattatcttgagaaattacgtggtagaagaaaatttaacactaaaa |
32982141 |
T |
 |
| Q |
182 |
caatgtttggatcctctccaacttccaatttctggattgaact |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982140 |
caatgtttggatcctctccaacttccaatttctggattgaact |
32982098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University