View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9901_high_26 (Length: 221)
Name: NF9901_high_26
Description: NF9901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9901_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 17593951 - 17594115
Alignment:
| Q |
19 |
gactacaaacataatatgagattatttaaccttttgttttatttagttattgatcttattaatcacacaacataggaaaataaatacattaggatgagtt |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
17593951 |
gactacaaacaaaatatgagattatttaacattttgttttatttagttattgatcttattaatcacacaacatagggaaataaatatatttggatgagtc |
17594050 |
T |
 |
| Q |
119 |
ccatgaacgagcatagctcagctgacactgatagggacattacagtatgcaaatatcggggttggaactcc |
189 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
17594051 |
ccatgaacgagcatagctcagccgac------agggacattacaatatgcaaatatcagggttggaactcc |
17594115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University