View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9901_high_27 (Length: 213)

Name: NF9901_high_27
Description: NF9901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9901_high_27
NF9901_high_27
[»] chr8 (1 HSPs)
chr8 (20-198)||(301625-301803)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 301625 - 301803
Alignment:
20 ataggggatggtgagtttttcataatcatatctgaaatagtctgcagtttatatgtgtactttgtttgggggactgagcagtgattgataaggatttgtc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
301625 ataggggatggtgagtttttcataatcatatctgaaatagtctgcagtttatatgtgtactttgtttgggggactgagcagtgattgataaggatttgtc 301724  T
120 aataagttaggcttctttttcacttaatgtgtcacaggaacttttaatttttaaatatgttttcaaaatgagacctatg 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
301725 aataagttaggcttctttttcacttaatgtgtcacaggaacttttaatttttaaatatgttttcaaaattagacctatg 301803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University