View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9901_low_16 (Length: 288)
Name: NF9901_low_16
Description: NF9901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9901_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 13 - 168
Target Start/End: Original strand, 9681243 - 9681398
Alignment:
| Q |
13 |
gcaaaggtacaaggattgtttggtgctaaatcgaaaaaatctcaattatattcatttaatttgtgcttaatttgcggcctcctctaattgcactctccct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9681243 |
gcaaaggtacaaggattgtttggtgctaaatcgaaaaaatctcaattatattcatttaatttgtgcttaatttgcggcctcctctaattgcactctccct |
9681342 |
T |
 |
| Q |
113 |
ttcgttttaatgtgtgaccatacataaggcatgattatgcctcttcgaatgaaatg |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9681343 |
ttcgttttaatgtgtgaccatacataaggcatgattatgcctcttggaatgcaatg |
9681398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 9681452 - 9681502
Alignment:
| Q |
222 |
gagaactcaatgtcaacaaactgcaaaatcaacaagatttgatgatagaac |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9681452 |
gagaactcaatgtcaacaaactgcaaaatcaacaagatttgatgatagaac |
9681502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University