View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9901_low_20 (Length: 253)
Name: NF9901_low_20
Description: NF9901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9901_low_20 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 14 - 253
Target Start/End: Complemental strand, 32982532 - 32982293
Alignment:
| Q |
14 |
cagagaatgcaagagaggtacttgaagaagttggtaaggaaaatgtggaaactgcatgggatgcaacaaagaaaactgtacaattggtgacagagacaac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32982532 |
cagagaatgcaagagaggtacttgaagaagttggtaaggaaaatgtggaaactgcatgggatgcaacaaagaaaactgtacaattggtgactgagacaac |
32982433 |
T |
|
| Q |
114 |
cacagctgaggctgatatgaatgttgtggacactgcggagtatagaagtagtgaagatttatcagggcaacttggagatggctgtgataagattcagtta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982432 |
cacagctgaggctgatatgaatgttgtggacactgtggagtatagaagtagtgaagatttatcagggcaacttggagatggctgtgataagattcagtta |
32982333 |
T |
|
| Q |
214 |
taattaatacatataggaattaataagagggtaatcccat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982332 |
taattaatacatataggaattaataagagggtaatcccat |
32982293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 27038071 - 27037952
Alignment:
| Q |
35 |
ttgaagaagttggtaaggaaaatgtggaaactgcatgggatgcaacaaagaaaactgtacaattggtgacagagacaaccacagctgaggctgatatgaa |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27038071 |
ttgaagaagttggtaaggaaaatgtggaaactgcatgggatgctacaaagaacactgtacaattggtgacagagacaaccactgctgaggctgatatgaa |
27037972 |
T |
|
| Q |
135 |
tgttgtggacactgcggagt |
154 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
27037971 |
tgccgtggacactgcggagt |
27037952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University