View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9901_low_22 (Length: 246)
Name: NF9901_low_22
Description: NF9901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9901_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 102 - 243
Target Start/End: Complemental strand, 12560291 - 12560148
Alignment:
| Q |
102 |
ggaaggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttggg-tagaccttaggctagcaccc-tccaaagtgcaat |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
12560291 |
ggaaggggctgcgcgaacgcaaacccccacggcaacaaattatgatgtaggctccaccacttggggtagaccttaggctagcacccctccaaagtgcaat |
12560192 |
T |
 |
| Q |
200 |
ggaggtcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12560191 |
ggaggtcacttgcctaggccatgggccttcttgatcacccattg |
12560148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 105 - 243
Target Start/End: Original strand, 9211370 - 9211509
Alignment:
| Q |
105 |
aggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagcacc-ctccaaagtgcaatggag |
203 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| || |
|
|
| T |
9211370 |
aggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagcacctcttcaaagtgcaatgaag |
9211469 |
T |
 |
| Q |
204 |
gtcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9211470 |
gtcacttgcctaggccatgggccttcctgatcacccattg |
9211509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 102 - 243
Target Start/End: Original strand, 19242372 - 19242514
Alignment:
| Q |
102 |
ggaaggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatg |
200 |
Q |
| |
|
||||||||| ||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||| |
|
|
| T |
19242372 |
ggaaggggccgcgcgaacgcaggcccccgctgcaacaaattatgatgtaggctccaccacttgggtagaccttagactagcacccctcctaagtgcaatg |
19242471 |
T |
 |
| Q |
201 |
gaggtcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19242472 |
gaggtcacttgcctaggccatgggccttcttgatcacccattg |
19242514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 105 - 243
Target Start/End: Complemental strand, 9370115 - 9369976
Alignment:
| Q |
105 |
aggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggag |
203 |
Q |
| |
|
|||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| || |
|
|
| T |
9370115 |
aggggccgcgcgaacgcaagccccaaccacaacatattatgatgtaggctccaccacttgggtagaccttaggctagcaccccttcaaagtgcaatgaag |
9370016 |
T |
 |
| Q |
204 |
gtcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9370015 |
gtcacttgcctaggccatgggcctttttgatcacccattg |
9369976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 133 - 243
Target Start/End: Complemental strand, 12557016 - 12556905
Alignment:
| Q |
133 |
gcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggaggtcacttgcctaggccatgggccttctt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||| | | ||||| ||| |||||||| |
|
|
| T |
12557016 |
gcaacaaattatgatgtaggctccaccacttgagtagaccttaggccagcacccctccaaagtgcaatggaggtcattgtcttaggctatgagccttctt |
12556917 |
T |
 |
| Q |
232 |
gatcacccattg |
243 |
Q |
| |
|
||||||| |||| |
|
|
| T |
12556916 |
gatcacctattg |
12556905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 106 - 208
Target Start/End: Complemental strand, 35182148 - 35182045
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||| | ||||| | | ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
35182148 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctgttctacttgagaacaccttagactagcacccctccaaagtgcaatggagg |
35182049 |
T |
 |
| Q |
205 |
tcac |
208 |
Q |
| |
|
|||| |
|
|
| T |
35182048 |
tcac |
35182045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 106 - 243
Target Start/End: Complemental strand, 38783971 - 38783833
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||| | ||||| | | |||||| | ||| |||||| |||||||||||||| |
|
|
| T |
38783971 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctgttctacttgagaacaccttaagtaggcacccctcctaagtgcaatggagg |
38783872 |
T |
 |
| Q |
205 |
tcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
38783871 |
tcaccaacctaggccatggaccttcttgatcatccattg |
38783833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 102 - 243
Target Start/End: Complemental strand, 35923389 - 35923247
Alignment:
| Q |
102 |
ggaaggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatg |
200 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
35923389 |
ggaaggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggcaagcacccctcctaagtgcaatg |
35923290 |
T |
 |
| Q |
201 |
gaggtcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35923289 |
gaggtcacttgcctaggccatgggccttcatgatcacccattg |
35923247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 106 - 243
Target Start/End: Complemental strand, 1466922 - 1466784
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||||| | |
|
|
| T |
1466922 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttagaaaggcacccctcctaagtgcaatggaag |
1466823 |
T |
 |
| Q |
205 |
tcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
1466822 |
tcacctttctaggccatgggccttcttgatcacccattg |
1466784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 106 - 243
Target Start/End: Original strand, 5050501 - 5050639
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||| | | ||||| | | ||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
5050501 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggttgttctacttgagaacaccttaggcgagcacccctcctaagtgcaatggagg |
5050600 |
T |
 |
| Q |
205 |
tcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||| |||||||||||| |||| ||||||| |||||| |
|
|
| T |
5050601 |
tcaccaacctaggccatggacctttttgatcatccattg |
5050639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 106 - 243
Target Start/End: Original strand, 19538755 - 19538893
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
19538755 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctccaccacttaggtagaccttaggatagcacccctccaaagtgcaatggagg |
19538854 |
T |
 |
| Q |
205 |
tcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
19538855 |
tcactttcctaggccatgggccttcgtgatcacccattg |
19538893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 106 - 243
Target Start/End: Original strand, 19545406 - 19545544
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19545406 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttagaagagcacccctccaaagtgcaatggagg |
19545505 |
T |
 |
| Q |
205 |
tcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||| |
|
|
| T |
19545506 |
tcacttttctaggccataggccttcatgatcacccattg |
19545544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 112 - 243
Target Start/End: Complemental strand, 47228672 - 47228540
Alignment:
| Q |
112 |
gcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggaggtcactt |
210 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||| |||||||||| | || |||||| |||||||||||||||||| | |
|
|
| T |
47228672 |
gcgcgaacgcagaccccctcagcaacaaattataatgtaggctccaccacttggatagaccttagaaaaacacccctcctaagtgcaatggaggtcacct |
47228573 |
T |
 |
| Q |
211 |
gcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| |
|
|
| T |
47228572 |
ttctaggccataggccttcatgatcacccattg |
47228540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 140 - 243
Target Start/End: Original strand, 47465706 - 47465810
Alignment:
| Q |
140 |
attatgatgtaggctccaccacttgggtagaccttaggctagcaccc-tccaaagtgcaatggaggtcacttgcctaggccatgggccttcttgatcacc |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||| ||| |||||||||||||| ||| | ||||||||||||||||| |||||||| |
|
|
| T |
47465706 |
attatgatgtaggctccaccacttgagtagaccttagaaaagcacccctcccaagtgcaatggaggccacctttctaggccatgggccttcatgatcacc |
47465805 |
T |
 |
| Q |
239 |
cattg |
243 |
Q |
| |
|
||||| |
|
|
| T |
47465806 |
cattg |
47465810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 136 - 243
Target Start/End: Original strand, 19549755 - 19549864
Alignment:
| Q |
136 |
acaaattatgatgtagg-ctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggaggtcacttgcctaggccatgggccttcttga |
233 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| |||||| | |||| |||||| |||||||||||| |||||| | ||||| |||||||||| |||| |
|
|
| T |
19549755 |
acaaattatgacgtaggtctccaccacttgggtgagccttagacaagcaaccctcctaagtgcaatggaagtcactcgtctaggtcatgggccttattga |
19549854 |
T |
 |
| Q |
234 |
tcacccattg |
243 |
Q |
| |
|
|||||||||| |
|
|
| T |
19549855 |
tcacccattg |
19549864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 136 - 243
Target Start/End: Original strand, 19554968 - 19555076
Alignment:
| Q |
136 |
acaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggaggtcacttgcctaggccatgggccttcttgat |
234 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| | |||||| | |||| |||||| ||||||||||||||| ||| | ||||| ||||| |||| ||||| |
|
|
| T |
19554968 |
acaaattatgacgtaggcaccaccacttgggtgggccttagaccagcaaccctcctaagtgcaatggaggttactcgtctaggtcatggacctttttgat |
19555067 |
T |
 |
| Q |
235 |
cacccattg |
243 |
Q |
| |
|
|| |||||| |
|
|
| T |
19555068 |
catccattg |
19555076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 19551971 - 19552029
Alignment:
| Q |
183 |
accctccaaagtgcaatggaggtcacttgcctaggccatgggccttcttgatcacccat |
241 |
Q |
| |
|
||||||| ||||||||||||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
19551971 |
accctcctaagtgcaatggaggtcactcgtctaggtcatgggccttcttgatcacccat |
19552029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 103 - 241
Target Start/End: Complemental strand, 26640868 - 26640729
Alignment:
| Q |
103 |
gaaggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatgg |
201 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||| |||||| ||||||||||| |
|
|
| T |
26640868 |
gaaggggccgcgcgaacgcaggcccccactgcaacaaattatgatgtaggttccaccacttgggtagaccttagactagcacccctcctaagtgcaatgg |
26640769 |
T |
 |
| Q |
202 |
aggtcacttgcctaggccatgggccttcttgatcacccat |
241 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26640768 |
aggtcacttgtctaggccatgggccttcttgatcacccat |
26640729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 106 - 243
Target Start/End: Complemental strand, 9450849 - 9450711
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
9450849 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggaaggcacccctccaaagtgcaatggagg |
9450750 |
T |
 |
| Q |
205 |
tcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
9450749 |
tcaccttcctaggccatgggccttcttgatcacccattg |
9450711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 106 - 243
Target Start/End: Complemental strand, 17724698 - 17724560
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| | |||||||||||| |
|
|
| T |
17724698 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggaaggcacccctcctatgtgcaatggagg |
17724599 |
T |
 |
| Q |
205 |
tcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
17724598 |
tcaccttcctaggccatgggccttcttgatcacccattg |
17724560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 106 - 243
Target Start/End: Complemental strand, 19025927 - 19025789
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| | |||||||||||| |
|
|
| T |
19025927 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggaaggcacccctcctatgtgcaatggagg |
19025828 |
T |
 |
| Q |
205 |
tcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
19025827 |
tcaccttcctaggccatgggccttcttgatcacccattg |
19025789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 106 - 243
Target Start/End: Original strand, 28838383 - 28838521
Alignment:
| Q |
106 |
ggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggagg |
204 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
28838383 |
ggggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttagaaaggcacccctcctaagtgcaatggagg |
28838482 |
T |
 |
| Q |
205 |
tcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
28838483 |
tcaccttcctaggccatgggccttcttgatcacccattg |
28838521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 107 - 243
Target Start/End: Original strand, 20798757 - 20798893
Alignment:
| Q |
107 |
gggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagcacc-ctccaaagtgcaatggaggt |
205 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
20798757 |
gggctgcgcgaacgcaagccccg-ctgcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagcacctttcctaagtgcaatggaggt |
20798855 |
T |
 |
| Q |
206 |
cacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
20798856 |
cacttgcctaggccatgaacattcttgatcacccattg |
20798893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 102 - 243
Target Start/End: Original strand, 28830414 - 28830556
Alignment:
| Q |
102 |
ggaaggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatg |
200 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
28830414 |
ggaaggggccgcgcgaacgcaggcccccacaacaacaaattatgatgtaggctccaccacttgggtagaccttagaaaagcacccctcctaagtgcaatg |
28830513 |
T |
 |
| Q |
201 |
gaggtcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||||||| | ||||||||||| |||||||||||| |||||| |
|
|
| T |
28830514 |
gaggtcacctttctaggccatggaccttcttgatcatccattg |
28830556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 124 - 237
Target Start/End: Original strand, 3427899 - 3428013
Alignment:
| Q |
124 |
gcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggaggtcacttgcctaggccatg |
222 |
Q |
| |
|
||||| || ||||||||||| |||||| |||||||||||||| |||||||| ||||||| |||||||| |||||||||||||||| |||||| | ||| |
|
|
| T |
3427899 |
gcccctactgcaacaaattacgatgtaaactccaccacttgggcagaccttaagctagcacccctccaaggtgcaatggaggtcacacgcctagacgatg |
3427998 |
T |
 |
| Q |
223 |
ggccttcttgatcac |
237 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3427999 |
ggccttcttgatcac |
3428013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 102 - 243
Target Start/End: Complemental strand, 9937435 - 9937293
Alignment:
| Q |
102 |
ggaaggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatg |
200 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||| ||||||||||||| | ||||| | | ||||||| ||| |||||| |||||||||| |
|
|
| T |
9937435 |
ggaaggggccgcgcgaacgcaggcccccacagcaacaaactatgatgtaggctgttctacttgagaacaccttagataggcacccctccgaagtgcaatg |
9937336 |
T |
 |
| Q |
201 |
gaggtcacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
|||||||| |||||||||||| ||||| |||||| |||||| |
|
|
| T |
9937335 |
gaggtcaccaacctaggccatggaccttcatgatcatccattg |
9937293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 107 - 243
Target Start/End: Complemental strand, 9939802 - 9939665
Alignment:
| Q |
107 |
gggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggaggt |
205 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||| | | ||||| | | |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9939802 |
gggccgcgcgaacgcaggcccccacagcaacaaattatgatgtaggttgttctacttgagaacaccttaggtaggcacccctccaaagtgcaatggaggt |
9939703 |
T |
 |
| Q |
206 |
cacttgcctaggccatgggccttcttgatcacccattg |
243 |
Q |
| |
|
||| |||||||||| | ||||| |||||| |||||| |
|
|
| T |
9939702 |
caccaacctaggccatagaccttcatgatcatccattg |
9939665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 113 - 235
Target Start/End: Complemental strand, 9945847 - 9945721
Alignment:
| Q |
113 |
cgcgaacgcaagcccccacagcaacaaattatgatgtaggctcc---accacttgggtagaccttaggctagca-ccctccaaagtgcaatggaggtcac |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| | | ||||| | | ||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
9945847 |
cgcgaacgcaggcccccacagcaacaaattataatgtaggctgctgttctacttgagaacaccttaggcagacacccctccaaagtgcaatggaggtcac |
9945748 |
T |
 |
| Q |
209 |
ttgcctaggccatgggccttcttgatc |
235 |
Q |
| |
|
|||||||||| | ||||| ||||| |
|
|
| T |
9945747 |
caacctaggccatagaccttcatgatc |
9945721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 102 - 175
Target Start/End: Original strand, 7959611 - 7959684
Alignment:
| Q |
102 |
ggaaggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagacctta |
175 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
7959611 |
ggaaggggccgcgcgaacgcagacccccacagcaacaaattatgatgtaggctccaccatttggatagacctta |
7959684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 135 - 238
Target Start/End: Original strand, 43923991 - 43924084
Alignment:
| Q |
135 |
aacaaattatgatgtaggctccaccacttgggtagaccttaggctagcaccctccaaagtgcaatggaggtcacttgcctaggccatgggccttcttgat |
234 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||| |||| |||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43923991 |
aacaaattataatgtaggctccaccacttgagtagaccttaaactagaaccc----------aatgaaggtcacttgcctaggccatgggccttcttgat |
43924080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 237
Target Start/End: Complemental strand, 44089833 - 44089700
Alignment:
| Q |
105 |
aggggctgcgcgaacgcaagcccccacagcaacaaattatgatgtaggctccaccacttgggtagaccttaggctagca-ccctccaaagtgcaatggag |
203 |
Q |
| |
|
|||||| ||||||||||| |||||| ||||||||||||||||||||| || | ||||| | | ||||||| ||| |||||||||||||||||||| |
|
|
| T |
44089833 |
aggggccgcgcgaacgcaggccccctcagcaacaaattatgatgtagactgttctacttgagaacaccttagataggcacccctccaaagtgcaatggag |
44089734 |
T |
 |
| Q |
204 |
gtcacttgcctaggccatgggccttcttgatcac |
237 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||| |
|
|
| T |
44089733 |
gtcaccaacctaggccatgagccttcatgatcac |
44089700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University