View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9901_low_32 (Length: 215)
Name: NF9901_low_32
Description: NF9901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9901_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 193
Target Start/End: Complemental strand, 20494039 - 20493860
Alignment:
| Q |
14 |
agaagcaaaggtaacttatttcacttattaaatgtttaaattgttcaagaacatagttctacacaataaaaacaaaagttacaaaatctagttatctaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
20494039 |
agaagcaaaggtaacttatttcacttattaaatgtttaaattgttcaagaacatagttctacacaataaaaacaaaagttacataagctagttatctaaa |
20493940 |
T |
 |
| Q |
114 |
tagaaattcaaacaacagatttaatatactcagcttcataagtagcagcatcaacaaacacaacttgataaacctcatgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20493939 |
tagaaattcaaacaacagatttaatatactcagcttcataagtagcagcatcaacaaacacaacttgataaacctcatgt |
20493860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 178
Target Start/End: Complemental strand, 20476103 - 20476069
Alignment:
| Q |
144 |
cagcttcataagtagcagcatcaacaaacacaact |
178 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
20476103 |
cagcttcataagaagcagcatcaacaaacacaact |
20476069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University