View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9902_high_15 (Length: 237)
Name: NF9902_high_15
Description: NF9902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9902_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 10 - 113
Target Start/End: Complemental strand, 32371970 - 32371867
Alignment:
| Q |
10 |
gttttcaagcttaacagttccctgttgattattcctttttgagtgatttcagcatttgctttatacaagttctcttaccttctggcttttgcctgatttt |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32371970 |
gttttcaagcttaacggttccctgttgattattcctttttgagtgatttcagcatttgctttatacaagttctcttaccttctggattttgcctgatttt |
32371871 |
T |
|
| Q |
110 |
aagg |
113 |
Q |
| |
|
|||| |
|
|
| T |
32371870 |
aagg |
32371867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 224
Target Start/End: Complemental strand, 32371816 - 32371746
Alignment:
| Q |
154 |
atgccttcatgttttcttagtgcataagcttaatatcttgagattaatgttttttgtgccatgttgttatt |
224 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
32371816 |
atgcattcatgttttcttagtgcataagcttaatatgttgggattaatgttttttgtgccatgttgttatt |
32371746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University