View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9902_low_12 (Length: 348)
Name: NF9902_low_12
Description: NF9902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9902_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 106 - 330
Target Start/End: Original strand, 39031792 - 39032016
Alignment:
| Q |
106 |
aaaattgtaatatttaattttcttatgaannnnnnnnnncttgactcaaaagcaccagttaactacatcttatgataattagttaattacgttttctatg |
205 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||| || |||| |||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
39031792 |
aaaattgcaatatttaattttcttatgaatttttttttcattgactcagaaacaccggttaactagatcttatgataattagttaatttatttttctatg |
39031891 |
T |
 |
| Q |
206 |
atagaagaacatttcacaaccatatacacaataccaataaatacaatgcaaaatgatataggaaggaccaagacgtgtaccaataaattaatgggaagta |
305 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39031892 |
atagacgaacatttcacaaccatatacacaacaccaataaatacaatgcaaaatgatataggaaggaccaagacgtgtaccaataaattaatgggaagta |
39031991 |
T |
 |
| Q |
306 |
ggaacaatttgattaaattagatgt |
330 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39031992 |
ggaacaatttgattaaattagatgt |
39032016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University