View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9902_low_18 (Length: 280)
Name: NF9902_low_18
Description: NF9902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9902_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 20 - 270
Target Start/End: Complemental strand, 25378401 - 25378151
Alignment:
| Q |
20 |
ggatttgtttaactatggtttgtttgttttgtcctatgggtttggactttgcatgaaattatgcaacattttgttatgttagtgttattgttactttttc |
119 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25378401 |
ggattggtttaactatggtttgtttgttttgtcctatgggtttggactttgcatgaaattatgcaacattttgttattttagtgttattgttactttttt |
25378302 |
T |
 |
| Q |
120 |
taaatttgatatctttcgcgtgcaattttgaataccaacatctctgattttgagacttaaatgaacagctaaatcttttacgtacaactttctcagattt |
219 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| || |||||| ||||| |
|
|
| T |
25378301 |
taaatttgatatctttcgcgtgcaactttgaatacctacatctctgattttgagacttaaatgaacaactaaatcttttacgtataattttctcggattt |
25378202 |
T |
 |
| Q |
220 |
tgtgagaccgaaatggttgttaaactttagttaagttagaattgacctatg |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25378201 |
tgtgagaccgaaatggttgttaaactttagttaagttagaattaacctatg |
25378151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University