View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9902_low_22 (Length: 240)
Name: NF9902_low_22
Description: NF9902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9902_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 65 - 224
Target Start/End: Complemental strand, 12881986 - 12881827
Alignment:
| Q |
65 |
gccatattctgtagcgccgcatattccatcaccaccgacgttctcaaccttcttccctcgctcagtctcgtcgttacttccagtgttggaactgatcaca |
164 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12881986 |
gccatattctgcagcgccgcatattccatcaccaccgacgttctcaaccttcttccctcgctcagtctcgtcgttacttccagtgttggaactgatcaca |
12881887 |
T |
|
| Q |
165 |
ttgaccttaatgagtgccgtcgtcgcggaattcaggttgccggtgctggaggagttttct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12881886 |
ttgaccttaatgagtgccgtcgtcgcggaattcaggttgccggtgctggaggagttttct |
12881827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University