View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9903_low_14 (Length: 215)
Name: NF9903_low_14
Description: NF9903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9903_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 10 - 76
Target Start/End: Original strand, 44344250 - 44344316
Alignment:
| Q |
10 |
agaagcaaagggtgatgaaaatgagaaattgagaaggaaaattcagattattattattgctgggatt |
76 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344250 |
agaaccaaaaggtgatgaaaatgagaaattgagaaggaaaattcagattattattattgctgggatt |
44344316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 145 - 196
Target Start/End: Original strand, 44344383 - 44344434
Alignment:
| Q |
145 |
agatgtatgttagtttttatacttacaagtgaaaatgaaatgatgagaagag |
196 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44344383 |
agatgtaggttagtttttttacttacaagtgaaaatgaaatgatgagaagag |
44344434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University