View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9904_high_13 (Length: 252)
Name: NF9904_high_13
Description: NF9904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9904_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 20 - 140
Target Start/End: Complemental strand, 26322084 - 26321964
Alignment:
| Q |
20 |
gtaggctttcaaaagctgccgatattattggtggacaggtgctggatgtcaccaatagggtaaaagaagctttttctgttcagaaagagcttttgattaa |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26322084 |
gtaggctttcgaaagctgccgatattattggtggacaggtgctggatgtcaccaatagggtaaaagaagctttttctgttcagaaagagcttttgattaa |
26321985 |
T |
|
| Q |
120 |
gctcaaacaaactcaggttcg |
140 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26321984 |
gctcaaacaaactcaggttcg |
26321964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 204 - 252
Target Start/End: Complemental strand, 26321900 - 26321852
Alignment:
| Q |
204 |
gcatgtcacattgtcaatgataatgacattgcttttgcgtgttattttt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26321900 |
gcatgtcacattgtcaatgataatgacattgcttttgcgtgttattttt |
26321852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University