View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9904_high_13 (Length: 252)

Name: NF9904_high_13
Description: NF9904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9904_high_13
NF9904_high_13
[»] chr4 (2 HSPs)
chr4 (20-140)||(26321964-26322084)
chr4 (204-252)||(26321852-26321900)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 20 - 140
Target Start/End: Complemental strand, 26322084 - 26321964
Alignment:
20 gtaggctttcaaaagctgccgatattattggtggacaggtgctggatgtcaccaatagggtaaaagaagctttttctgttcagaaagagcttttgattaa 119  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26322084 gtaggctttcgaaagctgccgatattattggtggacaggtgctggatgtcaccaatagggtaaaagaagctttttctgttcagaaagagcttttgattaa 26321985  T
120 gctcaaacaaactcaggttcg 140  Q
    |||||||||||||||||||||    
26321984 gctcaaacaaactcaggttcg 26321964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 204 - 252
Target Start/End: Complemental strand, 26321900 - 26321852
Alignment:
204 gcatgtcacattgtcaatgataatgacattgcttttgcgtgttattttt 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
26321900 gcatgtcacattgtcaatgataatgacattgcttttgcgtgttattttt 26321852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University