View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9904_low_12 (Length: 288)
Name: NF9904_low_12
Description: NF9904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9904_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 270
Target Start/End: Original strand, 6878338 - 6878594
Alignment:
| Q |
14 |
agaaacgcgtggtgaagtcagggccgatttccaaagtagcaacgtaacctaatgtgatcaggtttctcaacaatcctatgccaatggattttgcttctgg |
113 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878338 |
agaagcgcgtggtaaagtcagggccgatttccaaagtagcaacgaaacctaatgtgatcaggtttctcaacaatcctatgccaatggattttgcttctgg |
6878437 |
T |
|
| Q |
114 |
tcgtgacggaactgagaaaatgatgaatggtaagcatgataaggttttaaagctcgccccgccatcaacagtgggtggagttgggcttgctttaaggtat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6878438 |
tcgtgacggaactgagaaaatgatgaatggtaagcatgataaggttttaaagctcgccccgccatcaacagtgggtggagttgggcttgctttgaggtat |
6878537 |
T |
|
| Q |
214 |
gctaatctgatcctactggcggagcgttgtctccatgcgcccgcgacagttggagag |
270 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878538 |
gctaatttgatcctactggcggagcgttgtctccatgcgcccgcgacagttggagag |
6878594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University