View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9904_low_19 (Length: 239)
Name: NF9904_low_19
Description: NF9904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9904_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 97 - 225
Target Start/End: Complemental strand, 43602042 - 43601914
Alignment:
| Q |
97 |
ttgatcttaaccgtttcctgacttatctggtggcattaattgtaagtccattaatggtactccttcaagtttcaatcataaaagcagctcaccaaatggc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602042 |
ttgatcttaaccgtttcctgacttatctggtggcattaattgtaagtccattaatggtactccttcaagtttcaatcataaaagcagctcaccaaatggc |
43601943 |
T |
 |
| Q |
197 |
ctgaaatttgacatcccaatttccatatg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43601942 |
ctgaaatttgacatcccaatttccatatg |
43601914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 43602099 - 43602041
Alignment:
| Q |
1 |
catttgagggaaatataaataaatttcttttgaattaactgatgaggactgattgattatttt |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602099 |
catttgagggaaatataaat----ttcttttgaattaactgatgaggactgattgattatttt |
43602041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University