View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9904_low_23 (Length: 203)
Name: NF9904_low_23
Description: NF9904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9904_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 177
Target Start/End: Complemental strand, 24147237 - 24147074
Alignment:
| Q |
14 |
cagagacttggcaactagcacaagacaacgccactagctagaaggtgagcaacattgtttgtttgtctccgaagaaaacttatctgaaagtttggtaaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
24147237 |
cagagacttggcaactagcacaagacaacgccactagctagaaggtgagcaacattgtttgtttgtctccgaagaaaacttatccgtaagtttggtaaag |
24147138 |
T |
|
| Q |
114 |
aatataaaaatgttttgcaagcacataaaatactaccccactctgttgtatgacttggtctccc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24147137 |
aatataaaaatgttttgcaagcacataaaatactaccccactttgttgtatgacttggtctccc |
24147074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 17 - 177
Target Start/End: Complemental strand, 24152673 - 24152513
Alignment:
| Q |
17 |
agacttggcaactagcacaagacaacgccactagctagaaggtgagcaacattgtttgtttgtctccgaagaaaacttatctgaaagtttggtaaagaat |
116 |
Q |
| |
|
||||||||||||||||| ||||||| || |||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24152673 |
agacttggcaactagcataagacaatgcgactagctagaaggtgaacaatattgtttgtttgtctccgaagaaaacttatccgaaagtttggtaaagaat |
24152574 |
T |
|
| Q |
117 |
ataaaaatgttttgcaagcacataaaatactaccccactctgttgtatgacttggtctccc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24152573 |
ataaaaatgttttgcaagcacataaaatactaccccactatgttgtatgacttggtctccc |
24152513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 61 - 184
Target Start/End: Original strand, 44006577 - 44006699
Alignment:
| Q |
61 |
agcaacattgtttgtttgtctccgaagaaaacttatctgaaagtttggtaaagaatataaaaatgttttgcaagcacataaaatactaccccactctgtt |
160 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||| | || |||||||||||||||||| || | ||| | ||||| ||||| ||||| ||| ||||||| |
|
|
| T |
44006577 |
agcaacattgttggtttgtctccgaataaaacctctccaaaagtttggtaaagaatacaagattgtcgtacaagccaataaagtactatccc-ctctgtt |
44006675 |
T |
|
| Q |
161 |
gtatgacttggtctccccgccatg |
184 |
Q |
| |
|
||||||| ||||| ||||||||| |
|
|
| T |
44006676 |
ctatgactaggtcttcccgccatg |
44006699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 59 - 106
Target Start/End: Original strand, 21330785 - 21330832
Alignment:
| Q |
59 |
tgagcaacattgtttgtttgtctccgaagaaaacttatctgaaagttt |
106 |
Q |
| |
|
||||||||||| ||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
21330785 |
tgagcaacattatttatttgtctccgaataaaacttatcttaaagttt |
21330832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University