View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9904_low_7 (Length: 448)
Name: NF9904_low_7
Description: NF9904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9904_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-100; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 98 - 363
Target Start/End: Complemental strand, 6761945 - 6761681
Alignment:
| Q |
98 |
aaaggaaaatcgccggtgacttgtttatcgctatttcgcaaagtaaattcagctagccatgaacctggaaaaactccagtttatcttaatgtgtatgact |
197 |
Q |
| |
|
||||||||||| ||||||||| |||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6761945 |
aaaggaaaatcaccggtgactcgtttttctttatttcgcaaagtaaattcagctagccatggacctggaaaaactccagtttatcttaatgtgtatgact |
6761846 |
T |
|
| Q |
198 |
tggtacccatgaatggttatgtgtattgggccggtcttggtatctatcactccagtgtcgaaggtacggttttaggctcgtatggcatcaaatttgctca |
297 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| | |||||||| ||| |
|
|
| T |
6761845 |
tgacacccatgaatggttacgtgtattgggccggtcttggtatctatcactctggtgtcgaaggtacggtttt-ggctcgtatgtcttcaaatttaatca |
6761747 |
T |
|
| Q |
298 |
tgctctgcctcttaatcttggcatatgacttaaattaacctggctttttctcaaatgtattagaat |
363 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
6761746 |
tgctctgtctcttaatcttggcatatgacttaaattatcctggccttttctcaaatgtattagaat |
6761681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 21 - 132
Target Start/End: Complemental strand, 6752611 - 6752502
Alignment:
| Q |
21 |
gatgctctatcaaacatttgttgaatgcaggtactatgcgagtgtcaccttagggaaagatgaaattgaactctaagaaaggaaaatcgccggtgacttg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
6752611 |
gatgctctatcaaacatttgttgaatgcaagtactatgtgagtgtcaccttagggaaagatgaaattgaa--ctaagaaaggaaaatcaccggtgacttg |
6752514 |
T |
|
| Q |
121 |
tttatcgctatt |
132 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6752513 |
tttatcgctatt |
6752502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 30 - 103
Target Start/End: Complemental strand, 6762047 - 6761973
Alignment:
| Q |
30 |
tcaaacatttgttgaatgcaggtactatgcgagtgt-caccttagggaaagatgaaattgaactctaagaaagga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6762047 |
tcaaacatttgttgaatgcaggtactatgtgagtgttcgccttagggaaagatgaaattgaagtctaagaaagga |
6761973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University