View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9905_low_7 (Length: 297)
Name: NF9905_low_7
Description: NF9905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9905_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 8e-64; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 108 - 250
Target Start/End: Original strand, 38387897 - 38388040
Alignment:
| Q |
108 |
ccaaattgtgttgggattaaaaagggtctttttgtagaaaaaatagagatgcataag-taagaaaagtaatagtataagttttatctatgatggaaatct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38387897 |
ccaaattgtgttgggattaaaaagggtctttttgtagaaaaaatagagatgcatacggtaagaaaagtaatagtataagttttatctatgatggaaatct |
38387996 |
T |
|
| Q |
207 |
acgttattgggcctacaacccatcaagcctcttgttggccctgt |
250 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38387997 |
atgtttttgggcctacaacccatcaagcctcttgttggccctgt |
38388040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 11 - 108
Target Start/End: Original strand, 38387489 - 38387586
Alignment:
| Q |
11 |
cagagatagtcagtttaagaatcataccaacatcctaatttcatccttgtgttttaggttattgttagtcgttttcttcttctcttaatcaaaaatcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||| ||||| |||||||||||| |
|
|
| T |
38387489 |
cagagatagtcagtttaagaatcataccaacatcctaattccatccttgtgttttaggctattgttagttgttttcttcgtctctcaatcaaaaatcc |
38387586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 281
Target Start/End: Original strand, 38388062 - 38388091
Alignment:
| Q |
252 |
ttctctaaacaaaagtcgttcagtatgatt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38388062 |
ttctctaaacaaaagtcgttcagtatgatt |
38388091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University