View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9906_high_5 (Length: 266)
Name: NF9906_high_5
Description: NF9906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9906_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 19394356 - 19394591
Alignment:
| Q |
18 |
cttccaatgtagtttttggttgttgaaggtaggtcatcctcacccttgatgacacatttttgtaagacgaatgcggtgtttgattttgagtcgattcttc |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19394356 |
cttccaatgtagttcttggttgttgaaggtaggtcatcctcacccttgatgacacatttttgtaagacgaatgcggtgtttgattttgagtcgattcttc |
19394455 |
T |
 |
| Q |
118 |
cattcgctgtaatgatgnnnnnnnggttgtcaagtggctttctaagaaccaattggcagttttggaagactgcggaggcatggccgaagatgaaatcgat |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19394456 |
cattcgctgtaatgatgtttttttggttgtcaagtggctttctaagaaccaattggcagttttggaagactgcggaggcatggccgaagatgaaatcgat |
19394555 |
T |
 |
| Q |
218 |
tgtgccagaaatgacacagtcgcggtagaattgtct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19394556 |
tgtgccagaaatgacacagtcgcggtagaattgtct |
19394591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 252
Target Start/End: Original strand, 8731526 - 8731578
Alignment:
| Q |
200 |
gccgaagatgaaatcgattgtgccagaaatgacacagtcgcggtagaattgtc |
252 |
Q |
| |
|
||||||||||||||||||||| || | ||| |||||||||||||||||||| |
|
|
| T |
8731526 |
gccgaagatgaaatcgattgttccgtatatgtgacagtcgcggtagaattgtc |
8731578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University