View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9906_high_7 (Length: 212)

Name: NF9906_high_7
Description: NF9906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9906_high_7
NF9906_high_7
[»] chr7 (1 HSPs)
chr7 (15-177)||(45580139-45580301)


Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 45580301 - 45580139
Alignment:
15 accaatttcaaatccctaaccctaaccccccaaaacctaattcttgtcattttattttgtgttattaacagtgtgaagnnnnnnntggcagaactgagtt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||    
45580301 accaatttcaaatccctaaccctaaccccccaaaacctaattcttgtcattttattttgtgttattaacagtgtgaagaaaaaaatggcagaactgagtt 45580202  T
115 tgggaattctaattgacatcgttgatgaggattggatgagagacactcttcctcaagatggta 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45580201 tgggaattctaattgacatcgttgatgaggattggatgagagacactcttcctcaagatggta 45580139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University