View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9906_low_11 (Length: 212)
Name: NF9906_low_11
Description: NF9906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9906_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 45580301 - 45580139
Alignment:
| Q |
15 |
accaatttcaaatccctaaccctaaccccccaaaacctaattcttgtcattttattttgtgttattaacagtgtgaagnnnnnnntggcagaactgagtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45580301 |
accaatttcaaatccctaaccctaaccccccaaaacctaattcttgtcattttattttgtgttattaacagtgtgaagaaaaaaatggcagaactgagtt |
45580202 |
T |
 |
| Q |
115 |
tgggaattctaattgacatcgttgatgaggattggatgagagacactcttcctcaagatggta |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45580201 |
tgggaattctaattgacatcgttgatgaggattggatgagagacactcttcctcaagatggta |
45580139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University