View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9906_low_8 (Length: 249)
Name: NF9906_low_8
Description: NF9906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9906_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 236
Target Start/End: Complemental strand, 43439325 - 43439099
Alignment:
| Q |
3 |
tttctttcaataattgtcacatatatattagtattatcatttgtctacttggacctgattttttgtcctatttagtgatttaaaatcgaagttgattatg |
102 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439325 |
tttctttcaataattgtcacatat----tagtattatcatttgtctacttggacctgattttttgtcctatttagtgatttaaaatcgaagttgattatg |
43439230 |
T |
 |
| Q |
103 |
attttgcagtgttgataaagtggacgacgaagctagctgctgaagataggaagtgggtagcacgagatagacttttaggttgtgttacttagcaacatca |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439229 |
attttgcagtgttgataaagtggacgacgaagcta---gctgaagataggaagtgggtagcacgagatagacttttaggttgtgttacttagcaacatca |
43439133 |
T |
 |
| Q |
203 |
gactttaatgttgaagatatttttgatttttcct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43439132 |
gactttaatgttgaagatatttttgatttttcct |
43439099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University