View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9908_low_3 (Length: 212)
Name: NF9908_low_3
Description: NF9908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9908_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 144 - 196
Target Start/End: Complemental strand, 4638053 - 4638001
Alignment:
| Q |
144 |
atgaatgttggataatgtttctaaaaattgatttatatgtttttgggtctgtg |
196 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4638053 |
atgaatgttggataatgtttcttaaaattgatttatatgtttttgggtctgtg |
4638001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 4638177 - 4638133
Alignment:
| Q |
20 |
tcttggtcatcaagcataaggttttgtgattctgggagttggtgc |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4638177 |
tcttggtcatcaagcataaggttttgtgattctgggagttggtgc |
4638133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 144 - 191
Target Start/End: Complemental strand, 27261434 - 27261387
Alignment:
| Q |
144 |
atgaatgttggataatgtttctaaaaattgatttatatgtttttgggt |
191 |
Q |
| |
|
|||| |||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
27261434 |
atgagtgttggttaatgttttttaaaattgatttatatgtttttgggt |
27261387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University