View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9910_high_27 (Length: 253)
Name: NF9910_high_27
Description: NF9910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9910_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 85 - 152
Target Start/End: Complemental strand, 40575295 - 40575228
Alignment:
| Q |
85 |
caaccatatgaactcgttcattattttccacagttaaaaaggaaaattgtacatcaaactatgtattg |
152 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
40575295 |
caaccatatgaactcattcattatttgccacagttaaaaaggaaaatgatacatcaaacaatgtattg |
40575228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 40575370 - 40575328
Alignment:
| Q |
14 |
gagaattacaactgcagaaagctcttgaaatatgaggctcatt |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40575370 |
gagaattacaactgcagaaagctcttgaactatgaggctcatt |
40575328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 40575193 - 40575133
Alignment:
| Q |
152 |
gagtatcatgtaacttttcaaagccgtaaactatatattttggtttcagtagagatctatc |
212 |
Q |
| |
|
||||||||| ||||||||||||||| |||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
40575193 |
gagtatcatttaacttttcaaagccataaattatatattttggttttggtagaaatctatc |
40575133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 43834411 - 43834469
Alignment:
| Q |
1 |
catggaaaatatggagaattacaactgcagaaagctcttgaaatatgaggctcattcag |
59 |
Q |
| |
|
||||||||| || ||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43834411 |
catggaaaacatagagaattgcaactgcagaaagctcttgaaatatgaggttcattcag |
43834469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 43834855 - 43834911
Alignment:
| Q |
178 |
taaactatatattttggtttcagtagagatctatcaggtgcttgctttataatgata |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||| ||| |||||||||||| |
|
|
| T |
43834855 |
taaactatatattttggtttcagtagagacctaacaggttgttggtttataatgata |
43834911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University