View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9910_high_39 (Length: 232)
Name: NF9910_high_39
Description: NF9910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9910_high_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 38600015 - 38599815
Alignment:
| Q |
18 |
aatacaaccacatcagttcaagggatttgtaacaaaatgaacataaaatacaaacagacaatattgtaatagcaagcctaatccttataattatctaaaa |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38600015 |
aatacaaccacatcagttcaggggatttataacaaaatgaacataaaatacaaacagacagtattgtaatagcaagcctaatccatataattatctaaaa |
38599916 |
T |
|
| Q |
118 |
tgcaatctgaaaatcacactgatctcagttcgccggaaaaatcaaaacctcaccggaaaacgccaatggagttcttcatcatcgcaaatttctcttcttc |
217 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||| ||||||||||||||||| | |||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
38599915 |
tgcaatctggaaatcgcactgatctcagtttgccgggaaaatcaaaacctcaccagcaaacgccagcggagttcttcatcgtcgcaaatttctcttcttc |
38599816 |
T |
|
| Q |
218 |
t |
218 |
Q |
| |
|
| |
|
|
| T |
38599815 |
t |
38599815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University