View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9910_low_18 (Length: 350)
Name: NF9910_low_18
Description: NF9910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9910_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 16 - 336
Target Start/End: Original strand, 16623943 - 16624265
Alignment:
| Q |
16 |
agaagcaggaagaagacaaggcggaagtcaaacatcattcatttgagtgagtattgtgaatatttatgtgattattccattttatatgctagatctaatt |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16623943 |
agaagcaggaagaagacaaggcgaaagtcaaacatcattcatttgggtgagtattgtgaatatttatgtgattattccattttatatgctagatctaatt |
16624042 |
T |
 |
| Q |
116 |
aaggtgttttttccttttgttttgtcttgtttgcaggataaatgaatcttccaatagactagtaagaacagaaaggatgatgtctctccggtccacaagt |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16624043 |
aaggtgttttgtccttttgttttgtcttgtttgcaggataaatgaatcttccaatagaccagtaagaacagaaaggatgatgtctctccggtccacaagt |
16624142 |
T |
 |
| Q |
216 |
tcttccatgaaggttttcctaaattttttatctgattattgcttcatattattaacg-taatttcatattttcaaaccagtatcaaagttttatgcattt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16624143 |
tcttccatgaaggttttcctaaattttttatctgattattgcttcatattattaacgataatttcatattttcaaaccagtatcaaagttttatgcattt |
16624242 |
T |
 |
| Q |
315 |
cccctc-tttttcatgttcatat |
336 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
16624243 |
cccctcttttttcatgttcatat |
16624265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University