View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9910_low_24 (Length: 323)
Name: NF9910_low_24
Description: NF9910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9910_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 7 - 308
Target Start/End: Original strand, 32320589 - 32320890
Alignment:
| Q |
7 |
gagaagcagagaagacctacaatcttggccttctaataggaggaaatcttcgtcaattaaggttttgctgccatttgcttgactgtatcaaaaagaagtt |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32320589 |
gagaagcaaagaagacctacaatcttggccttctaataggaggaaatcttcgtcaattaaggttttgctgccatttgcttgactgtatcaaaaagaagtt |
32320688 |
T |
 |
| Q |
107 |
atcacggtgtaagagtagaaatacttcttagggtggtagttgggttcttctgaaaaaatttcttgtttttgttaccggtttaatttatttccatcttcaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32320689 |
atcacggtgtaagagtagaaatacttcttagggtggtagttgggtttttttgaaaaaatttattgtttttgttaccggtttaatttatttccatcttcaa |
32320788 |
T |
 |
| Q |
207 |
gactcatacaaatataatttcttttattgaatctttatctaaatattttttatagggtgggagtgagaaagcttgaaaaatttgcggattatgtgtgatt |
306 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32320789 |
ggctcatacaaatataatttcttttattgaatctttatttaaatattttttatagggtgggagtgaggaagcttgaaaaatttgcggattatgtgtgatt |
32320888 |
T |
 |
| Q |
307 |
ga |
308 |
Q |
| |
|
|| |
|
|
| T |
32320889 |
ga |
32320890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 257
Target Start/End: Original strand, 14091495 - 14091573
Alignment:
| Q |
179 |
taccggtttaatttatttccatcttcaagactcatacaaatataatttcttttattgaatctttatctaaatatttttt |
257 |
Q |
| |
|
|||||||||| ||| ||||| |||||||| | | |||| ||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
14091495 |
taccggtttactttctttccttcttcaaggcccttacaggtataatttcttccattgaatctttatttaaatttttttt |
14091573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University