View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9910_low_37 (Length: 268)
Name: NF9910_low_37
Description: NF9910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9910_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 6 - 63
Target Start/End: Complemental strand, 32206858 - 32206801
Alignment:
| Q |
6 |
gcattcaacagtcctgaaagtgtcacctgttgaaattttgaaacaatcattttagttt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32206858 |
gcattcaacagtcctgaaagtgtcacctgttgaaattttgaaacaaacattttagttt |
32206801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 32182643 - 32182680
Alignment:
| Q |
1 |
ctgtcgcattcaacagtcctgaaagtgtcacctgttga |
38 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32182643 |
ctgtcgcattcaatagtcctgaaagtgtcacctgttga |
32182680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 32206139 - 32206098
Alignment:
| Q |
186 |
attatataaatctaaactaggttcatgtcatatacatcaaaa |
227 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
32206139 |
attatataaatctatacttggttcatgtcatatgcatcaaaa |
32206098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 32118866 - 32118898
Alignment:
| Q |
6 |
gcattcaacagtcctgaaagtgtcacctgttga |
38 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
32118866 |
gcattcaatagtcctgaaagtgtcacctgttga |
32118898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 32156786 - 32156818
Alignment:
| Q |
6 |
gcattcaacagtcctgaaagtgtcacctgttga |
38 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
32156786 |
gcattcaatagtcctgaaagtgtcacctgttga |
32156818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 32174562 - 32174594
Alignment:
| Q |
6 |
gcattcaacagtcctgaaagtgtcacctgttga |
38 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
32174562 |
gcattcaatagtcctgaaagtgtcacctgttga |
32174594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University