View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9910_low_62 (Length: 232)
Name: NF9910_low_62
Description: NF9910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9910_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 28730267 - 28730058
Alignment:
| Q |
1 |
caccgttgcttagttctttttagtttgtgctgcacttctttgtctcatgaattgtaactctgaatttgtagttagttcacactattatccatatatactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28730267 |
caccgttgcttagttctttttagtttgtgctgcacttctttgtctcatgaagtgaaactctgaatttgtagttaattcacactattatccatatatactc |
28730168 |
T |
|
| Q |
101 |
tatgttgcttaactagttcgttaataaaacaatttgtggatttagtctttacagattttcttgagagattatcttgtgtatgatgtatcaattcatggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730167 |
tatgttgcttaactagttcgttaataa-------tgtggatttagtctttacagattttctt--gagattatcttgtgtatgatgtatcaattcatggtt |
28730077 |
T |
|
| Q |
201 |
tcttacaagttgtgtatga |
219 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
28730076 |
tcttacaatttgtgtatga |
28730058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 9 - 164
Target Start/End: Complemental strand, 38120682 - 38120529
Alignment:
| Q |
9 |
cttagttctttttagtttgtgctgcacttctttgtctcatgaattgtaactctgaatttgtagttagttcacactattatccatatatactctatgttgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||| ||||||||||||||| | ||| ||||||||| |
|
|
| T |
38120682 |
cttagttctttttagtttgtgctgcacttctttgtctcatgaagtgaaactttgaatttgtagttaattcacactattatcc--aactacactatgttgc |
38120585 |
T |
|
| Q |
109 |
ttaactagttcgttaataaaacaatttgtggatttagtctttacagattttcttga |
164 |
Q |
| |
|
|||| |||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120584 |
ttaaatagttcttcaataaaacaatttgtggatttagtctttacagattttcttga |
38120529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 42
Target Start/End: Complemental strand, 3928143 - 3928106
Alignment:
| Q |
5 |
gttgcttagttctttttagtttgtgctgcacttctttg |
42 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
3928143 |
gttgcttagatctttttagtttgtgcagcacttctttg |
3928106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University